Jan 22, 2022
Singleplex qPCR for SARS-CoV-2 N1 and BRSV
- Chloe Svezia1,
- Anh Nguyen1,
- Jamie VanTassell1,
- Julia Raymond1,
- Marlene K Wolfe1,
- Pengbo1,
- Christine Moe1
- 1Center for Global Safe WASH, Rollins School of Public Health, Emory University, Atlanta Georgia USA
- Emory University
Protocol Citation: Chloe Svezia, Anh Nguyen, Jamie VanTassell, Julia Raymond, Marlene K Wolfe, Pengbo, Christine Moe 2022. Singleplex qPCR for SARS-CoV-2 N1 and BRSV. protocols.io https://dx.doi.org/10.17504/protocols.io.b2qyqdxw
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it’s working
Created: December 09, 2021
Last Modified: November 01, 2022
Protocol Integer ID: 55800
Keywords: wastewater, SARS-CoV-2, real-time, qPCR, RT-qPCR, Singleplex, N1, N1 target
Funders Acknowledgements:
Rollins School of Public Health, Emory University
Grant ID: N/A
Abstract
This protocol describes the procedure to perform RT-qPCR for the detection of the SARS-CoV-2 N gene and a processing control (BRSV) in RNA extracted from wastewater samples. For samples obtained with a Moore swab, results will indicate the presence or absence of each target. For grab or composite wastewater samples, results may be used to estimate the concentration of the target in the original sample.
Materials
Equipment:
- Autoclave - Amsco Lab 240 Steam Sterilizer
- CFX96 Touch Real-Time PCR System
- LabGard Biological Safety Cabinet - Class 2 A2 Biosafety Cabinet
- Ice bucket or tray
- -80°C sample storage freezer
- 4 sample storage freezer
- Eppendorf Research Plus Single Channel Pipette
- Eppendorf Repeater Pipette or Multichannel Pipette
- Disposable micropipette tips (10 μL, 100 μL, 1250 μL)
- GENIE® SI-0236 Vortex-Genie 2 Mixer
- PlateFuge MicroCentrifuge
Materials:
- Molecular grade water
- IDT N1 Primer and Probe Mix
- 4X TaqPath Master Mix
- BRSV Primer and Probe Mix
- 1-96 well Plate
- 1-96 well Plate sealant cover
- 2-1.7 microcentrifuge tubes
- 70% ethanol
- 10% bleach
- Ice
- KimWipes
- Positive control material
Primer and probe sequences:
| A | B | C | |
| Target | Component | Sequence | |
| N1 | Forward Primer | 5’-GAC CCC AAA ATC AGC GAA AT-3’ | |
| N1 | Reverse Primer | 5’-TCT GGT TAC TGC CAG TTG AAT CTG-3’ | |
| N1 | Probe | ACC CCG CAT TAC GTT TGG TGG ACC (5' FAM/ZEN/3' IBFQ) | |
| BRSV | Forward Primer | ACTCAGGACTTGTTCTTACCT | |
| BRSV | Reverse Primer | TGGTAGGACAGGGTTATCAAAC | |
| BRSV | Probe | ATGCTATCTCTGGGACCAAT (5’ FAM or Cy5/ZEN/3’ IBFQ) |
Software Preparation
Software Preparation
Open BioRad CFX Manager Program.
Setup the proper thermocycler conditions:
Thermocycling Conditions
Set up well plate template:
- Load the appropriate fluorophores into the appropriate wells (FAM is used for this assay).
- Select for designated controls (no template controls, negative, and positive), standards (with concentrations), and unknowns (samples).
- Name wells for samples accordingly.
Preparation
Preparation
Ensure that assay mix is prepared in advance for both N1 and BRSV assays (primers and probes mixed at appropriate concentrations and stored for future use at -20 °C , see Appendix I for details).
Ensure that standard curve aliquots have been prepared for SARS-CoV-2 (see Appendix II for details).
Note
- Standards should be made for list target cp/well and used for grab or composite samples.
- Swab samples require only a positive control.
Spray surface of hood and wipe pipettes with 10% bleach. Let dry, and repeat with 70% ethanol. Wipe off carefully.
Retrieve RNA from wastewater samples and thaw on ice.
Thaw the reagents from Invitrogen™, primers, and probes at Room temperature .
Prepare spreadsheet list of all samples to run to set up PCR template and to establish volumes needed for each reagent.
Note
- For grab/composite samples, include standard curve for SARS-CoV-2 and two "no template controls" (NTCs).
- If only using swab samples, include only a positive control and and two no template controls (NTCs)
Procedure
Procedure
Place all reagents on ice, including molecular biological grade water aliquot.
Confirm hood light is off to prevent denaturation of probes before starting mixture preparation.
Prepare two 1.7 mL microcentrifuge tubes labeled "N" and "B". Create the master mixes for each assay by mixing components under a clean hood in the order written in the tables below. Utilize the spreadsheet template to calculate the total volume of each component needed for the number of samples to be run.
| A | B | C | D | |
| N1 | N (μL/well) | Initial Concentration | Final Concentration / Well | |
| Molecular biology grade water | 8.5 μL | – | -- | |
| 4X TaqPath Master Mix | 5.0 μL | 4X | 1X | |
| IDT N1 Primer and Probe Mix | 1.5 μL | 13.3X | 1X | |
| Primers | -- | 4 μM | 300 nM | |
| Probe | -- | 2 μM | 150 nM | |
| Template RNA | 5 μL | – | – | |
| Total volume | 20.0 μL | – | -- |
N Master Mix
| A | B | C | D | |
| BRSV | B (μL/well) | Initial Concentration | Final Concentration / Well | |
| Molecular biology grade water | 8.0 μL | – | -- | |
| 4X TaqPath Master Mix | 5.0 μL | 4X | 1X | |
| BRSV Primer and Probe Mix | 2.0 μL | 10X | 1X | |
| Primers | -- | 4 μM | 400 nM | |
| Probe | -- | 2 μM | 200 nM | |
| Template RNA | 5 μL | – | – | |
| Total volume | 20.0 μL | – | -- |
B Master Mix
Vortex both N and B mixes for 5 seconds, then spin down for 5 seconds.
Aliquot 15 µL of the master mix to each designated well on the PCR plate. Change pipette tips between wells and dispose used pipette tips into trash.
Move the PCR plate to the lab’s PCR bench for adding template. Do not add template in the hood.
Spray surface of PCR bench and wipe pipettes with 10% bleach and then repeat with 70% ethanol. Wipe off carefully.
Retrieve thawed RNA from wastewater samples. Vortex briefly and spin down.
Add 5 µL of RNA template into the appropriate well on the PCR template, changing pipette tips in between each well.
For the PCR no template control (NTC), add 5 µL of molecular grade water.
For the extraction negative control, add 5 µL of control produced each time when extracting the RNA.
For positive control for Moore swab samples, add 5 µL of diluted inactivated SARS-CoV-2 sample stored in -80 °C freezer.
For the standard curve for grab or composite samples, add 5 µL of standards to designated wells in order, starting from the number of lowest to highest genomic copies (gc).
| Std G | Std F | Std E | Std D | Std C | |
| 10 gc | 100 gc | 1,000 gc | 10,000 gc | 100,000 gc |
gc = genomic copies
Once plate is completed, seal the wells with adhesive sealing film and spin down for 00:05:00 on a balanced 96-well plate centrifuge.
5m
Place samples in Bio-Rad Detection System and start PCR run with the appropriate thermocycling conditions as listed above.
Wipe down the pipette and surface with 10% bleach and then 70% ethanol.
Store leftover RNA samples in the freezer at -20 °C .
Viewing and Saving Data
Viewing and Saving Data
Export data as an Excel file or CSV file for viewing and analysis.
Interpreting Results
Interpreting Results
After viewing results, utilize the following decision tree to determine if results pass QA/QC.
Decision tree for interpreting qPCR results
- If both Ct values are present and the Ct difference is less than 2 --> Positive
- If the lower Ct value is less than 36 --> Quantifiable positive
- If the lower Ct value is greater than 36 --> Non-quantifiable positive
- If one Ct value is greater than 36 while the other is negative --> Negative
- If one Ct value is less than 36 while the other is negative --> Rerun sample
- If both Ct values are less than 36 and the Ct difference is greater than 2 --> Rerun sample
- If any Ct value of BRSV is negative --> Rerun sample
- For re-rerun results, if both Ct values are present and the difference is greater than 2 --> Positive, average the Ct values. Otherwise, follow the same aforementioned guideline
Appendix I - Primer/Probe Mix
Appendix I - Primer/Probe Mix
For each assay, combine primers and probes to create a stock mix with a concentration of 4 μM for each primer and 2μM for the probe.
Example to create 250 μL primer probe mix with 100 μM starting solutions:
- 10 μL Forward Primer (100 μM stock)
- 10 μL Reverse Primer (100 μM stock)
- 5 μL Probe (100 μM stock)
- 225 μL of microbiological grade H2O
Vortex the mixture on a benchtop vortex and place into a -20 °C freezer until needed for PCR.
Appendix II - Standard Curve Preparation
Appendix II - Standard Curve Preparation
The standard curve should be composed of the following and generated as a dilution series:
| A | B | C | D | E | F | G | |
| Dilution # | Name | RNA (μL) | Molecular Water (μL) | Final Volume (μL) | gc/μL | gc/5μL | |
| 1 | B | 27 | 73 | 100 | 200000 | 1000000 | |
| 2 | C | 30 | 270 | 300 | 20000 | 100000 | |
| 3 | D | 30 | 270 | 300 | 2000 | 10000 | |
| 4 | E | 30 | 270 | 300 | 200 | 1000 | |
| 5 | F | 30 | 270 | 300 | 20 | 100 | |
| 6 | G | 30 | 270 | 300 | 2 | 10 |
gc = genomic copies
Thaw Quantitative Synthetic SARS-CoV-2 RNA on ice. Add 27 µL of RNA into 73 µL of molecular water to create 100 μL dilution B.
Note
ATCC provides the concentration of RNA according to the LOT#. The RNA concentration of LOT# 70034420 is 7.4x 105 gc/μL.
Add 30 µL of dilution B into 270 µL of molecular water to create 300 μL dilution C. Vortex the mix.
Add 30 µL of dilution C into 270 µL of molecular water to create 300 μL dilution D. Vortex the mix.
Add 30 µL of dilution D into 270 µL of molecular water to create 300 μL dilution E. Vortex the mix.
Add 30 µL of dilution E into 270 µL of molecular water to create 300 μL dilution F. Vortex the mix.
Add 30 µL of dilution F into 270 µL of molecular water to create 300 μL dilution G. Vortex the mix.
Make 14 μL aliquots for each dilution and save at -20 °C freezer. Keep the remaining dilution B in the -70 °C freezer for future use.