Feb 02, 2023

Public workspaceQuantification of various SARS-CoV-2 variant mutations (characteristic of Alpha, Beta, Gamma, Delta, Omicron and Omicron sublineages) in settled solids using digital RT-PCR V.11

  • 1Verily Life Sciences;
  • 2Stanford University
  • Wastewater-based epidemiology working group
Icon indicating open access to content
QR code linking to this content
Protocol CitationBridgette Hughes, Bradley J. White, Marlene K. Wolfe, Alexandria B Boehm 2023. Quantification of various SARS-CoV-2 variant mutations (characteristic of Alpha, Beta, Gamma, Delta, Omicron and Omicron sublineages) in settled solids using digital RT-PCR. protocols.io https://dx.doi.org/10.17504/protocols.io.14egnzrrzg5d/v11Version created by Alexandria B Boehm
Manuscript citation:
We have a number of manuscripts and preprints that describe using these assays. Please contact aboehm@stanford.edu or check out the website: www.stanford.edu/~aboehm/research.htm
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: February 02, 2023
Last Modified: February 02, 2023
Protocol Integer ID: 76242
Keywords: SARS-CoV-2, wastewater, alpha, beta, gamma, variant, mutation, COVID-19
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK

The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
This process instruction describes the steps for quantitative analysis of nucleic acid from SARS-CoV-2 with a triplex Reverse Transcriptase droplet digital Polymerase Chain Reaction (RT-ddPCR) assay targeting the N Gene, S Gene and various mutation assays in extracted and purified RNA samples from solid wastewater samples for population level SARS-CoV-2 community surveillance. RT-ddPCR is a modified version of conventional RT-PCR workflows which involves separating the reaction mixture into many partitions (~20,000) before thermal cycling which allows for direct absolute quantification of the target RNA molecules.

Future protocols will be published that are complementary to this one and describe assays targeting additional SARS-CoV-2 mutations.

This protocol uses RNA extracted using this protocol: High Throughput RNA Extraction and PCR Inhibitor Removal of Settled Solids for Wastewater Surveillance of SARS-CoV-2 RNA. That RNA is generated from samples subjected to pre-analytical steps outlined in: High Throughput pre-analytical processing of wastewater settled solids for SARS-CoV-2 RNA analyses. It is recommended that these assays be run along assays for PMMoV and BCoV as controls as described in the companion protocol High Throughput SARS-COV-2, PMMOV, and BCoV quantification in settled solids using digital RT-PCR

The readout of this assay is a concentration of each target in the extracted RNA samples (copies/µL).

Scope
This process instruction applies to quantitative analysis of nucleic acid from SARS-CoV-2 RNA from solid wastewater samples with ddPCR using a Bio-Rad AutoDG Droplet Digital PCR system consisting of the AutoDG Automated Droplet Generator and the QX200 droplet reader.

Publications
The following publications describe use of these assays:

M. K. Wolfe, B. Hughes, D. Duong, V. Chan-Herur, K. R. Wigginton, B. White, A. B. Boehm. 2022. Detection of SARS-CoV-2 variant Mu, Beta, Gamma, Lambda, Delta, Alpha, and Omicron in wastewater settled solids using mutation-specific assays is associated with regional detection of variants in clinical samples. Applied and Environmental Microbiology. 88(8), e00045-22.Link.

A. B. Boehm, B. Hughes, M. K. Wolfe, B. J. White, D. Duong, V. Chan-Herur. Regional replacement of SARS-CoV-2 variant Omicron BA.1 with BA.2 as observed through wastewater surveillance. Accepted toEnvironmental Science & Technology Letters.Link to preprint.

Kirby AE, Welsh RM, Marsh ZA, Yu AT, Vugia DJ, Boehm AB, Wolfe MK, White BJ, Matzinger SR, Wheeler A, Bankers L, Andresen K, Salatas C, NYDEP, Gregory DA, Johnson MC, Trujillo M, Kannoly S, Smyth DS, Dennehy JJ, Sapoval N, Ensor K, Treangen T, Stadler LB, Hopkins L. 2022. Notes from the Field: Early Evidence of the SARS-CoV-2 B.1.1.529 (Omicron) Variant in Community Wastewater - United States, November - December 2021.MMWR Morb Mortal Wkly Rep2022;71:103- 105. DOI:http://dx.doi.org/10.15585/mmwr.mm7103a5.

A. Yu, B. Hughes, M. Wolfe, T. Leon, D. Duong, A. Rabe, L. Kennedy, S. Ravuri, B. White, K. Wigginton, A. Boehm, D. Vugia. 2022. Estimating relative abundance of two SARS-CoV-2 variants through wastewater surveillance at two large metropolitan sites.Emerging Infectious Disease, 28(5), 940-947.Link.





Materials
Equipment
●Bio-Rad QX200 AutoDG
●Bio-Rad QX200 Droplet Reader
●Bio-Rad PX1 PCR Plate Sealer (Bio-Rad, Catalog #:1814000)
●Agilent Bravo
●Eppendorf Master Cycler ProThermal Cycler
●Bio-Rad C1000 Touch Thermal Cycler
●Rainin Single-Channel Pipettes L1000XLS+, L200XLS+, L20XLS+, L10XLS+, , L2XLS+
●Rainin Multi-Channel Pipettes L12-1000XLS+, L12-200XLS+, L12-20XLS+, L12-10XLS+, L8-1000XLS+, L8-200XLS+, L8-20XLS+, L8-10XLS+
●Axygen Plate Centrifuge
●Benchtop vortex
●96-well plate cold block for AutoDG droplet generator
●96-well plate cold block for ddPCR plates
●Zebra GX430t label printer

Reagents
●ddPCR™ One-Step RT supermix for Probes
●Reverse Transcriptase
●300mM DTT
●Automated Droplet Generation Oil for Probes
●Ambion Nuclease Free Water, 50mL
●ddPCR Droplet Reader Oil

Consumables
●Bio-Rad ddPCR™ 96-Well Plates
●Eppendorf twin.tec PCR Plate
●DG32™ Automated Droplet Generator Cartridges
●PCR PX1 Plate Sealer, foil, pierceable
●Pipet Tips for the AutoDG™
●Rainin low retention, pre-sterilized, filter tips 1000 µL, 200 µL, 20 µL
●Axygen Automation Tips, 20 µl, filtered, sterile tips (Axygen 20 µL tips)
●Reagent Reservoirs
●Automation Reservoirs
●Eppendorf Tubes, 1.5mL, 2mL and 5mL.
●2.5” x 0.5” Cryogenic Labels for the Zebra GX430t label printer

Samples and Test Materials
●SARS-CoV-2 gRNA positive control (ATCC® VR-1986D™) diluted and aliquoted at a concentration of 50 copies per µL.
●Synthetic gene block containing the mutations purchased from IDT diluted and aliquoted at a concentration of 50 copies per µL.
●Heat inactivated SARS-CoV-2 B.1.1.7 (ATCC VR-3326HK™) diluted and aliquoted at a concentration of 50 copies per µL. Note: no RNA extraction is done.
●Other possible positive controls include cultivated viral RNA or TWIST synthetic genomes

Primer and Probe Sequences
See companion protocol for N and S gene primers and probes: High Throughput SARS-COV-2, PMMOV, and BCoV quantification in settled solids using digital RT-PCR. Additional protocols will be published or this protocol may be update to describe primer and probe sequences targeting other SARS-CoV-2 mutations.

ABC
TargetPrimer/ProbeSequence
HV69-70 delForwardACTCAGGACTTGTTCTTACCT
present in Alpha, BA.1, BA.4, and BA.5ReverseTGGTAGGACAGGGTTATCAAAC
ProbeATGCTATCTCTGGGACCAAT (5’ FAM or HEX/ZEN/3’ IBFQ)
E484K/N501YForwardCTGAAATCTATCAGGCCGGT
present in beta and gammaReverseGTTGGTAACCAACACCATAAG
ProbeCACACCTTGTAATGGTGTTAAAGGTT (5’ FAM or HEX/ZEN/3’ IBFQ)
del156-157/R158GForwardATTCGAAGACCCAGTCCCTA
present in DeltaReverseAGGTCCATAAGAAAAGGCTGA
ProbeTGGATGGAAAGTGGAGTTTATTCTAG (5’ FAM or HEX/ZEN/3’ IBFQ)
Del143-145ForwardATTCGAAGACCCAGTCCCTA
present in Omicron BA.1ReverseACTCTGAACTCACTTTCCATCC
ProbeTTGTAATGATCCATTTTTGGACCACAA (5’ FAM or HEX/ZEN/3’ IBFQ)
LPPA24SForwardGCCACTAGTCTCTAGTCAGTGTG
present in Omicron BA.2, BA.4, and BA.5ReverseTGTCAGGGTAATAAACACCACGT
ProbeCAGAACTCAATCATACACTAATTCTTTCAC (5’ FAM or HEX/ZEN/3’ IBFQ)
S:477-505ForwardCTATCAGGCCGGTAACAAAC
present in Omicron BA.1, BA.2, BA.4, and BA.5ReverseACTACTCTGTATGGTTGGTGAC
ProbeCCTTTACGATCATATRGTTTCCGACCC (5’ FAM/ZEN/3’ IBFQ)
ORF1a: del141-143ForwardTAATAAAGGAGCTGGTGGCC
present in Omicron BA.4ReverseATGAGTTCACGGGTAACACC
ProbeCGGCGCCGATCTAGACTTAG (5’ FAM/ZEN/3’ IBFQ)
S:K147E & S:W152RForwardCGAAGACCCAGTCCCTACTT
present in Omicron BA.2.75 and BA.2.75.2ReverseTCCATAAGAAAAGGCTGAGAGA
Probe CCACGAAAACAACAAAAGTCGGATG (5’ FAM/ZEN/3’ IBFQ)
Y445P, G446S, E484A, F486S/P and F490SForwardGGCTGCGTTATAGCTTGGAA
Present in XBB*ReverseGAGAGTAACAATTAGRACCTGCAAC
ProbeCTTGATTCTAAGCCTAGTGGTAATTATAAT (5' FAM/ZEN/3' IBFQ)
Primer and probes for the mutation assays. They are to be multiplexed with the assays for N and S as described in our companion protocol.


Protocol materials
ReagentOne-Step RT-ddPCR Advanced Kit for ProbesBio-Rad LaboratoriesCatalog #186-4021
ReagentOne-Step RT-ddPCR Advanced Kit for ProbesBio-Rad LaboratoriesCatalog #186-4021
Preparation
Preparation
Retrieve all kit components from the One-Step RT-ddPCR advanced kit for probes from the Temperature-20 °C freezer and thaw the components TemperatureOn ice .

ReagentOne-Step RT-ddPCR Advanced Kit for ProbesBio-rad LaboratoriesCatalog #186-4021


Note
This protocol describes a triplex assay for the N, S, and a mutation gene. Protocols targeting the HV69-70 deletion, E484K/N501 mutation, del156-157/R158G, del143-145, LPPA24S, S:477-505, ORF1a Del 141-143, and S:K147E & S:W152R are in this document, but it is possible to swap out one or two of the assays for others that also target low copy number targets using the same procedure. However, we do not recommend multiplexing with a high copy number target like PMMoV because a high copy number target assay would need to use diluted RNA as template.

Note that all primer and probe sequences are provided in the "Materials" link.


Retrieve ddPCR positive control aliquots (50 copies per uL gRNA) from the Temperature-80 °C freezer and thaw TemperatureOn ice

For re-running frozen plates only:

Thaw the RNA storage plate TemperatureOn ice . Before analysis of thawed frozen samples, ensure that the plate is adequately sealed and briefly vortex and centrifuge the plate to ensure the samples are well mixed.

Keep extracted RNA samples TemperatureOn ice or in a cold block from the freezer at all times.



ddPCR master mix preparation
ddPCR master mix preparation
45m
45m
Prepare Master Mix

Prepare a working stock of fresh nuclease free water by pouring from a 50 mL Ambion Nuclease Free water into a 5mL eppendorf tube.
Store Master Mix components TemperatureOn ice as much as possible during the preparation process.

Briefly vortex One-Step RT supermix for Probes (Yellow Tube), Reverse Transcriptase (Orange Tube), and DTT (Grey Tube) to mix contents then briefly spin with the benchtop centrifuge.

ReagentOne-Step RT-ddPCR Advanced Kit for ProbesBio-rad LaboratoriesCatalog #186-4021
In a 2mL eppendorf tube, prepare the master mix according to the table for SARS-CoV-2 quantification with HV69-70, E484K/N501Y, or del156-157/R158G. Store prepared master mix on ice.


Note
Additional protocols will be published for other mutations associated with SARS-CoV-2 variants.

Primer/Probes Mixes

ABC
20x ConcentrationFinal Concentration/Rxn
Primers (each)18 µM900 nM
N Probe (FAM)5 µM250 nM
S Probe (HEX)5 µM250 nM
XXX Probe (HEX)2.5 µM125 nM
XXX Probe (FAM)2.5 µM125 nM
The 20x SARS-CoV-2 and XXX Primer/Probe Mix contains primers and probes in the following concentrations (suspended in molecular grade water). XXX is the mutation of interest.




Master Mix

ABC
ReagentsVolume per WellVolume Per Plate
ddPCR™ One-Step RT supermix for Probes (Yellow Tube)5.5 µL580.8 µL
20x SARS-CoV-2 Primer/Probe Mix3.3 µL348.48 µL
Reverse Transcriptase (Orange Tube)2.2 µL232.32 µL
300mM DTT (Gray Tube)1.1 µL116.16 µL
Nuclease Free Water4.4 µL464.64 µL
Total Volume16.5 µL1742.4 µL
SARS-CoV-2 ddPCR Master Mix. Volume per plate assumes 96 well plate (with 10% excess).

Transfer Master Mix and Samples to ddPCR plate
Transfer Master Mix and Samples to ddPCR plate
For each assay, remove a cold block from the freezer and place a new Bio-Rad ddPCR 96-well Plate in it.
Note
Note that these steps may be completed with a liquid handling robot. We use the BRAVO system.


Using a new reagent reservoir, manually pipette Amount16.5 µL of the appropriate Master Mix to each well of each ddPCR Plate.
Transfer samples to the following wells on the plate either manually or using a liquid handling robot such as the Agilent Bravo system:
  • Transfer Amount5.5 µL of samples from columns 1-10 of the RNA plate into columns 1-10 of the ddPCR plate.
  • Transfer Amount5.5 µL of the extraction controls from column 12 of the RNA plate into column 11 of the ddPCR plate.
  • Transfer Amount5.5 µL of NTC (water) into A-G of column 12.
  • Add Amount5.5 µL of ddPCR positive control to well H12 of the ddPCR plate (add manually even if using a liquid handler)
Note
Use SARS-CoV-2 genomic RNA (ATCC® VR-1986D™) mixed 1:1 with appropriate mutation standard as ddPCR positive control (see materials section of the protocol). The extraction positive controls are generated during RNA extraction per this companion protocol: https://www.protocols.io/view/high-throughput-rna-extraction-and-pcr-inhibitor-r-btyrnpv6. In that protocol, the extraction positive control consists of SARS-CoV-2 genomic RNA that does not contain the mutations HV69-70 and E484K/N501Y or other mutation targets.

The plate layout should be:


Note
Note: The set up of this plate is slightly different from the set up of the 96 well extraction plate used in our companion protocol. Column 11 of this plate uses column 12 of the extraction plate. The lower right hand corner was purposely chosen for the placement of the positive controls.

Bring the BioRad ddPCR plate with Master Mix and samples to the Bio-Rad PX1 PCR Plate Sealer and place it in the metal carrier inside the plate sealer.
Note
Do not store the metal carrier inside the plate sealer, as it will become warm and warm the samples during sealing.

Align a PCR Plate Heat Seal Foil on top of the ddPCR plate with the red line facing up.
Seal the plate by pressing the green “seal” button.
Briefly vortex the plate using a bench top plate vortexer.

Briefly spin down the plate in the bench top Axygen Plate Centrifuge.
Store the ddPCR plate on a white cold block or TemperatureOn ice until droplet generation.

ddPCR droplet generation
ddPCR droplet generation
45m
45m
Generate Droplets:
On the AutoDG droplet generator: select “configure plate” and then press the blue arrow in the upper left corner to highlight all columns.

Load 3 DG32 cartridge plates and 2 tip boxes with the lid removed onto the AutoDG deck. The icons on the AutoDG display will change from yellow to green if the plates and tips are oriented correctly.

Place the sealed, vortexed, and centrifuged ddPCR plate in the Sample Plate position on the AutoDG deck.

Remove the AutoDG cooling block from the freezer and place it in the Droplet Plate slot on the AutoDG deck.

For the Droplet Plate: label a new Bio-Rad ddPCR™ 96-Well Plate and place it in the Auto DG cooling block.

Click “Generate Droplets” to begin droplet generation. Droplet generation will take approximately Duration00:45:00 .




45m
When droplet generation is done, open the lid and remove the droplet plate from the Auto DG cold block and place it in the metal carrier inside the plate sealer.


Note
The droplets are highly unstable at this stage. The droplets should not be left on the generator longer than they need to be. Once thermocycled the droplets are more stable.

Align a PCR Plate Heat Seal Foil on top of the droplet plate with the red line facing up.

Seal the plate by pressing the green “seal” button.

Note
NOTE: Do NOT vortex plate at this point!

Thermocycling
Thermocycling
45m
45m
Place the plate in the thermocycler. Verify and run the thermocycler program according to the table for SARS-CoV-2 ddPCR.
Note
The annealing temperature for the multiplex assay for N, S, and HV69-70 is 59°C and N/S/ all other mutations is higher (61°C). A higher annealing temperature is necessary to ensure high specificity for the other mutation assays, and we found that the N and S assays performed with the same amplitude/efficiency of reaction at 61°C as at 59°C.

For additional mutation assays, see those protocols for thermocycling conditions and take note of differences in recommended annealing temperature.


ABCD
StepsCycle #sTemp (°C)Time
115060 min
21955 min
3409530 secs
40591 min
419810 min
5-4hold
Cycling conditions for the N/S/HV69-70 multiplexed assay


ABCD
StepsCycle #sTemp (°C)Time
115060 min
21955 min
3409530 secs
40611 min
419810 min
5-4hold
Cycling conditions for the N/S/XXX multiplexed assay where XXX are all other mutations.



After the PCR program is done, store the ddPCR plate at Temperature4 °C (in the thermal cycler, on ice or in the fridge) until droplet reading.

Read Droplets
Read Droplets
Before running the plate on the QX200 droplet reader, open the drawer on the left side of the instrument and check that there is adequate droplet reader oil and that the waste bottle is not overly full.
Load template from previous plate of the same assay - ensure that all parameters (supermix, dye, absorbance etc.) are correct for the assay used and that sample names are assigned to the appropriate wells. Save as with a new plate name.


Note
Double check that the correct supermix label is used for the read and that the channels are labeled appropriately. These parameters can NOT be changed after you run the plate.

Name the file with a name clearly describing which plate you are reading.
Remove the plate from the thermal cycler and secure it in the droplet reader by placing it in the stage, placing the metal brace on top of it and pressing down the black plastic tabs on either side of the brace.
Click “Run” in Quantasoft to commence droplet reading.
Select “Ok” when the next dialog box comes up. Do not change the settings from “Columns” and “FAM/HEX”.
Post-Processing Analysis
Post-Processing Analysis
SARS-CoV-2 triplex assay analysis
Open QuantaSoft™ Analysis Pro Software
Open the .qlp file associated with the run

1.1.1.On the Plate Editor tab, select all the wells then in the dropdown menu for Assay Information select Probe Mix Triplex and complete as follows and click “Apply”:



At this point, if sample names were not added at the start of the run, fill in the sample name by selecting the wells, typing in sample ID and click “Apply”.
If wells need to be deselected: Go to the Plate Editor tab, select wells to exclude and click “Clear Selected Well”.
On the 2D Amplitude tab, make sure that all wells are highlighted and select the Threshold Cluster Mode Graph Tool
and draw 2D thresholds around each cluster as follows



Go through every well to ensure that:
  • The droplets are designated properly per well
  • There are >10,000 droplets per well
If any well does not have the appropriate droplets, go to the Plate Editor tab, select the affected well and click “Clear Selected Well”.
On the 2D Amplitude tab, select Merged Wells on the left side of the page

Click on the Table Menu Button on the right side of the Well Data table and select Export to CSV to export data.

Save the QuantaSoft Analysis
Dimensional Analysis and Quality Control
Dimensional Analysis and Quality Control
For dimensional analysis to express the results of each assay in terms of gene copies/dry weight solids:
Begin with the concentration provided by the QuantaSoft software and reported in the CSV, as expressed in gc/uL of reaction.
Note
This concentration is expressed in terms of the total volume of the merged wells, rather than the volume of the template added. Determination of gc/g relies on the ratio of of template in the reaction and mass in the volume eluted from extraction, so when beginning with this value expressed in terms of gc/uL the number of wells merged is not considered in the dimensional analysis.

To determine the concentration in cp/g dry weight:


Note
When using the assays described in the three protocols that make up this process as written:
  • B = 20 µL total reaction volume
  • A = 5 µL volume template in reaction
  • C = 60 µL elution volume from each well in extraction kit
  • Z = 0.0225 g wet weight of solids added to each extraction well (300 µl of a suspension of 75 mg wet weight solids / ml of solution)
  • Percent solids varies for each sample on each day (typical range 0.05 - 0.3, i.e. 5-30%)

Please note that there are many different ways to conceptualize the dimensional analysis. Please be sure to double check your own calculations to make sure they match with the measurement units from your instrument. For example, our instrument reports results as copies per the entire volume of the rxn, but some instruments may report a different concentration.

Links to two companion protocols to this protocol can be found in the description of this protocol.