Apr 14, 2025
Processing samples following intracellular FACS screen
- 1Duke University
- Gersbach Lab
Protocol Citation: Samuel Reisman, Charles Gersbach 2025. Processing samples following intracellular FACS screen . protocols.io https://dx.doi.org/10.17504/protocols.io.5qpvooyd7v4o/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: April 10, 2025
Last Modified: April 14, 2025
Protocol Integer ID: 126540
Funders Acknowledgements:
NIH
Grant ID: HG012053
Abstract
This protocols describes methods for processing samples following intracellular FACS screens.
Guidelines
Use fresh everything- Libraries are easy to contaminate. Preserve coverage at every step until after PCRs
Materials
Arcturus PicoPure DNA Extraction Kit
3M sodium acetate pH 5.5
20 mg/mL glycogen
100% ethanol
ice cold, 70% ethanol
1% agarose gel
Q5 2X Master Mix (New England Biolabs)
SPRI beads in PEG
80% ethanol
Qubit and reagents
PCRs primers to amplify the hU6-sgRNA-tracrRNA region from the genome and add adapters for sequencing. List of i7 primer options, barcode is bolded.
| i7_BC1_Miseq_gRNAlib_rev | CAAGCAGAAGACGGCATACGAGATACATCGGACTCGGTGCCACTTTTTCAA | |
| i7_BC2_Miseq_gRNAlib_rev | CAAGCAGAAGACGGCATACGAGATTGGTCAGACTCGGTGCCACTTTTTCAA | |
| i7_BC3_Miseq_gRNAlib_rev | CAAGCAGAAGACGGCATACGAGATCACTGTGACTCGGTGCCACTTTTTCAA | |
| i7_BC4_Miseq_gRNAlib_rev | CAAGCAGAAGACGGCATACGAGATATTGGCGACTCGGTGCCACTTTTTCAA | |
| i7_BC5_Miseq_gRNAlib_rev | CAAGCAGAAGACGGCATACGAGATGATCTGGACTCGGTGCCACTTTTTCAA | |
| i7_BC6_Miseq_gRNAlib_rev | CAAGCAGAAGACGGCATACGAGATTACAAGGACTCGGTGCCACTTTTTCAA | |
| i7_BC7_Miseq_gRNAlib_rev | CAAGCAGAAGACGGCATACGAGATCGTGATGACTCGGTGCCACTTTTTCAA | |
| i7_BC8_Miseq_gRNAlib_rev | CAAGCAGAAGACGGCATACGAGATGCCTAAGACTCGGTGCCACTTTTTCAA | |
| i7_BC9_Miseq_gRNAlib_rev | CAAGCAGAAGACGGCATACGAGATTCAAGTGACTCGGTGCCACTTTTTCAA | |
| i7_BC10_Miseq_gRNAlib_rev | CAAGCAGAAGACGGCATACGAGATAGCTAGGACTCGGTGCCACTTTTTCAA | |
| i7_BC11_Miseq_gRNAlib_rev | CAAGCAGAAGACGGCATACGAGATGTCGTCGACTCGGTGCCACTTTTTCAA | |
| i7_BC12_Miseq_gRNAlib_rev | CAAGCAGAAGACGGCATACGAGATCGATTAGACTCGGTGCCACTTTTTCAA |
Reverse Crosslinking
Reverse Crosslinking
- We use the Arcturus PicoPure DNA Extraction Kit. This protocol is for 10^5 – 10^6 cells. Scale up/down appropriately. We follow their protocol except we reverse crosslink overnight instead of their recommended 3 hours.
Add 155ul of Reconstitution Buffer into one vial of Proteinase K.
Gently vortex and immediately place on ice, use ASAP
To your pelleted cells, add 150ul reconstituted Proteinase K
Vortex gently to mix
Incubate samples at 65 C overnight
Incubate 95 C for 10 mins to inactivate Proteinase K
Ethanol Precipitation
Ethanol Precipitation
- Add 1/10 volume 3M sodium acetate pH 5.5, 2.2X volume 100% ethanol, and 1/100 volume of 20 mg/mL glycogen to tubes (i.e. for a 100 uL gibson reaction, add 1 uL glycogen, 10 uL sodium acetate, and 220 uL ethanol)
Freeze overnight at -80 C
Allow tube to thaw on ice (should only take a few minutes)
Centrifuge for 15 minutes at 15,000 g, 4C, precipitate should be a visible at bottom of tube
Gently remove supernatant by pouring
Do two consecutive washes with 1 mL of ice cold, 70% ethanol. Hold tube at 180 degree angle and slowly dispense volume of ethanol, gently tilt back and forth, and then pour off ethanol.
Use pipette to remove residual ethanol, but do not interfere with pellet
Allow DNA to dry by opening lid and placing tube on 37C heat block with kimwipe covering tube for ~5 minutes.
Resuspend DNA in small volume (~25 uL) of water, quantify using Nanodrop
PCRs
PCRs
Do a test PCR to ensure the rxn conditions are correct. If these look good, then proceed to full PCRs. Generally I do 1, 25ul PCR for each sample, then proceed to full if you see a clean band with each, but this can be modified depending on your coverage / volume / etc. These PCRs will amplify the hU6-sgRNA-tracrRNA region from the genome and add adapters for sequencing. See Materials for list of 12 barcode options for the i7 primer, barcode is bolded.
Set up test PCRs with i5 fwd primer, AATGATACGGCGACCACCGAGATCTACACAATTTCTTGGGTAGTTTGCAGTT,
and one of the i7 barcoded primers (see Materials).
| A | B | C | |
| Reagent | Single Rxn (25 ul) | Single Rxn (50 ul) | |
| Q5 2X MM | 12.5 | 25 | |
| Fw Primer i5_miseq_gRNAlib_fw 10uM | 1.25 | 2.5 | |
| Rev Primer: (i7 BC##) 10uM | 1.25 | 2.5 | |
| Template | 250 ng | 500 ng | |
| Water | To 25 ul | To 50 ul |
| A | B | C | |
| Initial denaturation | 98 C | 30 sec | |
| 25 cycles | 98 C | 10 sec | |
| 60 C | 30 sec | ||
| 72 C | 20 sec | ||
| Final Extension | 72 C | 2 min | |
| Hold | 4 C | inf |
Run 5 ul PCR product on a 1% agarose gel, check band (product should be ~270bp)
If bands look good, proceed to full PCRs. Match conditions exactly except you can scale up volume if needed to a max of 50ul
If you split sample across multiple tubes, mix product together so you have 1 tube for each sample. After this point, you can move forward with an aliquot of PCR product
Double-sided selection with SPRI beads
Double-sided selection with SPRI beads
Vortex SPRI bead bottle and aliquot required volume
Let SPRI beads in PEG solution equilibrate to RT
Add 0.6x SPRI beads to DNA based (i.e if 100 uL of DNA sample, add 60 uL of SPRI beads)
Incubate for 5 minutes
Place on magnet for 2 minutes
Transfer supernatant containing desired amplicon product and primer dimers into a new tube, beads contain unwanted plasmid DNA
Add 1.8x SPRI beads (since the PEG solution still remains from the 0.6x step, we only need to add 1.2x SPRI beads of the original volume, i.e if 100 uL of starting DNA sample, add 120 uL of SPRI beads)
Mix thoroughly by pipetting up and down 15+ times
Incubate at RT for 15 minutes
Place on magnet for 10 minutes
Discard supernatant containing primer dimer
Wash 2x with 200 uL freshly prepared 80% EtOH
Dry beads for 5 minutes on 37 C heat block with lid open and covered with KimWipe
Discard residual ethanol at bottom of tube
Elute with ~22 uL of H20
Mix thoroughly by pipetting up and down for 20+ times
Incubate at 37C heat block for 5 minutes, helps displace bound DNA from beads
Return to magnet for 2 minutes
Take ~20 uL of supernatant and transfer to a new tube
Measure DNA concentration with Qubit
Measure DNA concentration with Qubit
Collect reagents and bring to RT
Prepare working solution: 1 uL of 200x fluorescent reagent + 199 uL uL of buffer (make enough for half another reaction, i.e if measuring 6 samples, prepare 1300 uL of working solution (6.5 * 200 uL)
Add 190 uL of working solution to standard tubes and 198 uL of working solution to samples
Add 10 uL of standards and 2 uL of DNA samples to corresponding tubes
Vortex to mix and incubate at RT for 2 minutes
Measure concentrations and change home screen to calculate ng/uL for subsequent calculations
Calculate the volume of each sample to constitute a 2 nM concentration based on amplicon length
Prepare 2 nM working stocks of each library