Apr 01, 2025
Overloading and Unpacking (OAK) - Multiome V1
- 1Genentech
- Single cell genomics
Protocol Citation: Hayley Bennett, Bing Wu 2025. Overloading and Unpacking (OAK) - Multiome V1. protocols.io https://dx.doi.org/10.17504/protocols.io.n2bvjnyepgk5/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: April 16, 2024
Last Modified: April 01, 2025
Protocol Integer ID: 98315
Keywords: Multiome, OAK
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK
The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
High-throughput single-cell sequencing is a powerful technique for investigating the cellular diversity of complex biological systems. Throughput, cost effectiveness, and experimental simplicity are crucial forefronts of technological advancement in profiling single cells. We developed "overloading and unpacking" (OAK), a method that enables robustprofiling of hundreds of thousands of cells in a cost effective manner.
This protocol describes using OAK in conjunction with Chromium Next GEM Single Cell Multiome ATAC + Gene Expression Reagent Kits.
Materials
Plasticware:
- 2ml nuclease-free microfuge tubes.
Equipment:
- 10X Genomics Chromium Controller
- Swinging bucket centrifuge
Enzymes and reagents:
- Chromium Next GEM Single Cell Multiome ATAC Kit A, 16 rxns (PN-1000280, 10x Genomics)
- Chromium Next GEM Single Cell Multiome GEM Kit A, 16 rxns (PN-1000232, 10x Genomics)
- Chromium Next GEM Single Cell Multiome Gel Bead Kit A, 16 rxns (PN-1000231, 10x Genomics)
- 1 M DTT (P2325, Invitrogen) (dilute to 1 mM stock DTT just before use).
- Protector RNAse inhibitor, 40 U/µL (03335402001, Roche Diagnostics)
- KAPA HiFi 2X Hotstart Ready mix
- NEBNext 2X master mix (M0541S, NEB)
- Single Index Kit N Set A (PN-1000212, 10x Genomics)
Buffers and solutions:
- 16% Formaldehyde (w/v), Methanol-free (28908, Pierce)
- PBS (Ca2+, Mg2+ free) (10010-023, Gibco)
- 20X SSC (will be diluted to 3X) (AM9770, Invitrogen)
- Nuclease-free water (AM9937, Invitrogen)
- 1 M Tris-HCl (T1275, Teko)
- 5 M NaCl (AM9759, Invitrogen)
- 1 M MgCl2 (AM9261, Invitrogen)
- 10 % BSA in DPBS (A1595-50mL, Sigma)
- 10% Tween-20 (161-0781 Biorad)
General amplification primers:
| Primer name | Sequence | Stock concentration | |
| TSO enrichment primer | AAGCAGTGGTATCAACGCAGAGT | 100 µM | |
| Partial P5 Primer | AATGATACGGCGACCACCGAGA | 5 µM |
Pre-amplification primer mix:
Either use Pre-Amp Primers (2000271) from Chromium Next GEM Single Cell
Multiome Amp Kit A, 16 rxns PN-1000233, or prepare an equimolar mix of the following primers:
| Primer name | Sequence | Stock concentration | |
| ATAC-fwd | AATGATACGGCGACCACCGAGA | 100 µM | |
| ATAC-rev | GTCTCGTGGGCTCGG | 100 µM | |
| RNA-fwd | CTACACGACGCTCTTCCGATCT | 100 µM | |
| RNA-rev | AAGCAGTGGTATCAACGCAGAG | 100 µM |
Primers for addition of 2nd index (P5-i5index-TruseqR1) during cDNA amplification:
| Primer name | Sequence | C | Stock concentration | |
| P5_plateTT_A1_TruseqR1 | AATGATACGGCGACCACCGAGATCTACACAGTGTTACCTACACTCTTTCCCTACACGACGCTCTTCCGATCT | AGTGTTACCT | 100 µM | |
| P5_plateTT_B1_TruseqR1 | AATGATACGGCGACCACCGAGATCTACACACAGTTCGTTACACTCTTTCCCTACACGACGCTCTTCCGATCT | ACAGTTCGTT | 100 µM | |
| P5_plateTT_C1_TruseqR1 | AATGATACGGCGACCACCGAGATCTACACCAAGGATAAAACACTCTTTCCCTACACGACGCTCTTCCGATCT | CAAGGATAAA | 100 µM | |
| P5_plateTT_D1_TruseqR1 | AATGATACGGCGACCACCGAGATCTACACGCTTGTCGAAACACTCTTTCCCTACACGACGCTCTTCCGATCT | GCTTGTCGAA | 100 µM | |
| P5_plateTT_E1_TruseqR1 | AATGATACGGCGACCACCGAGATCTACACCTGTCCTGCTACACTCTTTCCCTACACGACGCTCTTCCGATCT | CTGTCCTGCT | 100 µM | |
| P5_plateTT_F1_TruseqR1 | AATGATACGGCGACCACCGAGATCTACACAGCGGGATTTACACTCTTTCCCTACACGACGCTCTTCCGATCT | AGCGGGATTT | 100 µM | |
| P5_plateTT_G1_TruseqR1 | AATGATACGGCGACCACCGAGATCTACACCTTGATCGTAACACTCTTTCCCTACACGACGCTCTTCCGATCT | CTTGATCGTA | 100 µM | |
| P5_plateTT_H1_TruseqR1 | AATGATACGGCGACCACCGAGATCTACACCGTACCGTTAACACTCTTTCCCTACACGACGCTCTTCCGATCT | CGTACCGTTA | 100 µM |
Primers for addition of P7 sequencing index (P7-i7index-TruseqR2) during GEX sequencing library amplification:
| Primer name | Sequence | Index sequence | Dilution of stock to use | |
| P7_SI-TT-A1 | CAAGCAGAAGACGGCATACGAGATCGCATGTTACGTGACTGGAGTTCAGACGTGT | GTAACATGCG | 5 µM | |
| P7_SI-TT-A2 | CAAGCAGAAGACGGCATACGAGATTTTGATCCACGTGACTGGAGTTCAGACGTGT | GTGGATCAAA | 5 µM | |
| P7_SI-TT-A3 | CAAGCAGAAGACGGCATACGAGATTTTCGTAGTGGTGACTGGAGTTCAGACGTGT | CACTACGAAA | 5 µM | |
| P7_SI-TT-A4 | CAAGCAGAAGACGGCATACGAGATCTCGCTAGAGGTGACTGGAGTTCAGACGTGT | CTCTAGCGAG | 5 µM | |
| P7_SI-TT-A5 | CAAGCAGAAGACGGCATACGAGATACAGGGCTACGTGACTGGAGTTCAGACGTGT | GTAGCCCTGT | 5 µM | |
| P7_SI-TT-A6 | CAAGCAGAAGACGGCATACGAGATTCACGCGTTAGTGACTGGAGTTCAGACGTGT | TAACGCGTGA | 5 µM | |
| P7_SI-TT-A7 | CAAGCAGAAGACGGCATACGAGATACCCTTGGGAGTGACTGGAGTTCAGACGTGT | TCCCAAGGGT | 5 µM | |
| P7_SI-TT-A8 | CAAGCAGAAGACGGCATACGAGATGTATACTTCGGTGACTGGAGTTCAGACGTGT | CGAAGTATAC | 5 µM | |
| P7_SI-TT-A9 | CAAGCAGAAGACGGCATACGAGATCTCTCCACTTGTGACTGGAGTTCAGACGTGT | AAGTGGAGAG | 5 µM | |
| P7_SI-TT-A10 | CAAGCAGAAGACGGCATACGAGATGCATGTCACGGTGACTGGAGTTCAGACGTGT | CGTGACATGC | 5 µM |
Before starting
Before starting
Prepare your single-cell suspension. We recommend starting with over 500K cells if possible, to ensure a visible pellet after the fixation step.
Prepare 4 mL nuclei wash buffer per sample, and place On ice .
Nuclei wash buffer:
| Reagent | B | Volume for 4 mL (µL) | Volume for 8 mL (µL) | |
| Tris-HCl | 1 M | 40 | 80 | |
| NaCl | 5 M | 8 | 16 | |
| MgCl2 | 1 M | 12 | 24 | |
| BSA | 10 % | 400 | 800 | |
| Tween-20 | 10 % | 40 | 80 | |
| DTT | 1 M | 4 | 8 | |
| RNase inhibitor | 40 U/µL | 100 | 200 | |
| Nuclease-free water | 3400 | 6800 |
Prepare 1 mL 1X nuclei buffer (part number 2000207, 10x` Genomics) and place On ice
1x nuclei buffer:
| Reagent stock | Volume (µL) | |
| Nuclei buffer (20X) | 50 | |
| 1 M DTT | 1 | |
| RNAse inhibitor (40 U/µL) | 25 | |
| Nuclease-free water | 924 |
Pre-cool a centrifuge with a swinging bucket to 4 °C . A swinging bucket is crucial for cell recovery. The cooled centrifuge is required for sections 2, 3, 5, 7 and 8 of the protocol.
Prepare 200 µL tubes for transposition step.
Prepare twenty labeled 200 µL tubes for aliquoting cells.
Optional: Pre-coat 2 mL microfuge tubes with BSA.
Nuclei isolation and fixation
Nuclei isolation and fixation
Prepare nuclei as suggested in the protocol provided by 10x Genomics (https://assets.ctfassets.net/an68im79xiti/G2F46chiuUKzVPL5tuiyy/1dc1908b5a77f5cd3abef59a750a2b54/CG000365_DemonstratedProtocol_NucleiIsolation_ATAC_GEX_Sequencing_RevA.pdf) or by your preferred method.
During the wash steps prepare the fresh 0.3% formaldehyde fixative buffer and store on wet ice. To do this add 18.75 µL 16% methanol-free formaldehyde solution to 981 µL PBS to make 1 mL total.
Wash the nuclei in the nuclei wash buffer in a round-bottom 2 mL microfuge tube. In the final wash, if necessary filter the nuclei with a 40 µm filter, then centrifuge between 500,000 and 2 million cells at 500 G for 5min.
Remove the supernatant and resuspend the nuclei pellet in the fixative buffer, pipette mix on addition to prevent the formation of clumps.
Place nuclei On ice for 10 min.
Post-fix wash
Post-fix wash
Pellet nuclei in a swinging-bucket centrifuge at 500G for 5 min at 4 °C .
Remove supernatant and dispose responsibly (contains formaldehyde). Add 1.5 mL nuclei wash buffer and centrifuge at 500G for 5 min at 4 °C .
Remove as much supernatant as possible without disturbing the pellet and resuspend cells gently in 200 µL diluted 1X nuclei buffer (part number 2000207, 10x Genomics).
Count the nuclei and adjust to a concentration of approximately 4000 nuclei/µL.
Transposition
Transposition
Dispense 5 µL of nuclei (20000 per transposition reaction) into 200 µL microfuge tubes.
Scale the number of reactions to the number of nuclei per channel. As some nuclei are inevitably lost prior to loading, we recommend transposing 200,000 nuclei in 10 reactions.
Prepare the mixture of TDE1 and TDE1 buffer
| Reagent | Volume (µL) | Mastermix, 10 reactions (µL) | |
| TDE1 buffer | 7 | 77 | |
| TDE1 | 3 | 33 |
Dispense the mastermix to each tube and place in the thermocycler at 37 °C for 60 min, as you would do for one tube in the standard 10x Genomics protocol (CG000338_ChromiumNextGEM_Multiome_ATAC_GEX_User_Guide_RevF).
Note: We have tried transposing the nuclei en masse in one reaction, instead of separate tubes, the results were similar to separate reactions run in parallel on the same sample, however with n=1 we are not quite confident to make this recommendation yet.
Combine transposed nuclei and overload 10X Chromium
Combine transposed nuclei and overload 10X Chromium
Using a single low-retention P200 pipette tip, combine all the reactions into one 2 mL microfuge tube.
Using 150 µL 1x nuclei buffer (part number 2000207, 10x Genomics), wash the sides of the tubes from which the nuclei were combined, and add to 2 mL microfuge tube containing the nuclei.
Centrifuge the combined nuclei at 500G for 10 min 4 °C . Remove supernatant leaving 16 µL solution around the pellet or expected pellet position. (Note: because of the lower number of nuclei the pellet may be clearly visible, we recommend keeping the supernatant until loading).
Resuspend the nuclei in the 16 µL solution with gentle pipetting. At this point you may want to take 1 µL and dilute in 1x nuclei buffer for counting in a haemocytometer, and to confirm a high concentration of nuclei.
Once ready, load the 10X Chromium as described in the standard multiome 10x Genomics protocol (CG000338_ChromiumNextGEM_Multiome_ATAC_GEX_User_Guide_RevF).
Modified reverse transcription
Modified reverse transcription
After GEM generation transfer the emulsion to a microfuge tube as described in the standard multiome 10x Genomics protocol.
Proceed with the reaction in a thermocylcer at 37 °C for 45 min then 25 °C for 30 min before cooling to 4 °C as described.
As soon as the thermocycler program is complete proceed immediately to the next step.
Unpacking the GEMS
Unpacking the GEMS
Add 125 µL 10x Genomics recovery agent to the GEMS and allow separation to occur. Do not invert or remove the recovery agent.
Using a low-retention P200 pipette tip, carefully transfer approx 80 µL aqueous solution into a 2 mL microfuge tube.
Add 800 µL of 3X SSC to the nuclei gently, without pipette mixing.
Proceed immediately to the next step.
Washing the cells
Washing the cells
Pellet cells in a swinging-bucket centrifuge at 650G for 5 min at 4 °C .
Remove supernatant, being careful not to disturb the pellet.
Add 1 mL of 3X SSC to the nucleigently, without pipette mixing.
Pellet cells in a swinging-bucket centrifuge at 650G for 5 min at 4 °C .
Distribute the cells into aliquots
Distribute the cells into aliquots
Work quickly for the best cell recovery.
Remove supernatant, being careful not to disturb the pellet.
Using a low-retention P200 pipette tip add 215 µL to the nuclei pellet, pipette up and down twice gently to resuspend, then with the same tip, aliquot 10 µL nuclei solution into twenty different 200 µL microfuge tubes.
Note: the number of nuclei aliquots is flexible, however we recommend for loads of 100,000-200,000 nuclei, twenty aliquots to reduced the collision rate of indexing.
Immediately store the dispensed nuclei at -80 °C .
QC of cell yield
QC of cell yield
Using any spare volume of nuclei that were not aliquoted (recommend 1:5 dilution in 3x SSC), 1:1 with trypan blue solutin and count on a haemocytometer. This will give an expected number of cells per aliquot, this information is useful to allow you to sequence sub-libraries at the correct depth.
Note: some debris is expected, a large amount of debris may indicate some lysis of nuclei in the experiment and could be detrimental to data quality.
Clean up of cell aliquots
Clean up of cell aliquots
Heat aliquots to -85 °C for 5 min.
Clean up using the Dynabeads Silane Viral NA kit (ThermoFisher, 37011D), following the protocol.
Elute each aliquot of cDNA in 23 µL by heating in a thermocycler to 50 °C for 10 min, tapping the tube at the midway point.
Place on a magnet and transfer the eluted cDNA to a new 200 µL microfuge tube.
Pre-amplification step
Pre-amplification step
Perform the pre-amplifcation step on the aliquots by adding the following mix. Do not combine the aliquots.
| Reagent | Volume (µL) | Volume in mastermix for 10 reactions (µL) | |
| NEBNext 2X PCR master mix | 25 | 275 | |
| Pre-Amp Primer Mix (10x Genomics 2000271, or own mix) | 2 | 22 | |
| Template | 23 | Add individually | |
| Total volume | 50 | X |
The thermal cycler program is as described in the standard 10x multiome protocol. CG000338_ChromiumNextGEM_Multiome_ATAC_GEX_User_Guide_RevF. However we recommend using 11 cycles of PCR.
Clean up the pre-amplification reactions
Clean up the pre-amplification reactions
On each aliquot, do a 1.6X SPRI bead clean up (use 80 µL beads) for the pre-amp products. Elute each aliquot in 40 µL EB.
ATAC-Seq library construction from the pre-amplification product
ATAC-Seq library construction from the pre-amplification product
Use 10 µL pre-amplification product from each aliquot to create sequencing libraries of the accessible chromatin component.
| Reagent | Volume (µL) | Volume in mastermix for 10 reactions (µL) | |
| NEBNext 2X PCR master mix | 50 | 550 | |
| P5_partial (100 µM) (SI- PCR Primer B) | 0.6 | 6.6 | |
| Nuclease-free water | 36.9 | 405.9 | |
| Sample Index N (PN-1000212 Single Index Kit N Set A) | 2.5 | Add individually | |
| Template | 10 | Add individually | |
| Total volume | 100 | X |
Use the following thermocycler program to amplify and add barcodes to the ATAC-Seq library. We recommend 15 cycles of PCR.
| Step | Temperature | Time | Cycle | |
| Initial denaturation | 98 °C | 30 s | 1x | |
| Denaturation | 98 °C | 10 s | ||
| Anneal | 67 °C | 30 s | ||
| Elongation | 72 °C | 20 s | Go to step 2. n times | |
| Final elongation | 72 °C | 2 min | 1x | |
| Hold | 4°C | Hold |
Note: the extension time is 20S as opposed to 30S to minimize larger fragments.
Perform double-sided clean-up as described in the standard 10X Genomics Chromium protocol. Take 3 µL for QC and store the library at 4 °C for up to 72hr or -20 °C until sequencing.
Use Qubit for quantification and Tapestation D1000 for size estimation.
Sequence to recommended depth based on the number of nuclei estimated from the aliquot cell count in Step 10.
Amplification of cDNA adding 2nd index
Amplification of cDNA adding 2nd index
This amplification uses a primer against the TSO sequence, and a long P5 primer that adds an index to the barcoded cDNA.
| Reagent | B | C | |
| 2X KAPA HiFi mix | 50 µL | ||
| 100 µM TSO enrichment primer | 0.4 µL | ||
| 100 µM P5-i5index-TruseqR1 | 0.4 µL | Note index used for each sample | |
| Nuclease-free water | 14.2 µL | ||
| cDNA | 35 µL |
For the number of cycles, use that recommended by the standard 10X Genomics Chromium protocol plus two.
| Step | Temperature | Time | Cycle | |
| Initial denaturation | 98 °C | 3 min | 1x | |
| Denaturation | 98 °C | 30 s | ||
| Anneal | 63 °C | 30 s | ||
| Elongation | 72 °C | 1 min 15 s | Go to step 2. n times | |
| Final elongation | 72 °C | 5 min | 1x | |
| Hold | 4°C | Hold |
Store at 4 °C for up to 72hr or -20 °C for up to a week.
Clean up amplified cDNA
Clean up amplified cDNA
SPRIselect and QC is performed on the amplified cDNA as described in the standard 10X Genomics Chromium protocol.
Store at 4 °C for up to 72hr or -20 °C for up to four weeks.
Gene expression (GEX) library preparation from amplified cDNA
Gene expression (GEX) library preparation from amplified cDNA
Fragmentation, End Repair & A-tailing and adaptor ligation steps with clean-up are all perfofmed on the amplified cDNA as described in the standard 10X Genomics Chromium protocol.
At the PCR stage, since we have already added the P5 index earlier, we use a primer to retain this index and add an i7 index.
| A | B | C | |
| 2X KAPA HiFi mix | 50 µL | ||
| 100 µM Partial P5 primer | 0.4 µL | ||
| 5 µM P7-i7index-TruseqR2 | 10 µL | Note index used for each sample | |
| Nuclease-free water | 9.6 µL | ||
| Cleaned up sample after adaptor ligation | 30 µL |
For the number of cycles, use that recommended by the standard 10X Genomics Chromium protocol based on cDNA input.
| Step | B | C | D | |
| Initial denaturation | 98 °C | 45 S | 1x | |
| Denaturation | 98 °C | 20 s | ||
| Anneal | 54 °C | 30 s | ||
| Elongation | 72 °C | 20 s | Go to step 2. n times | |
| Final elongation | 72 °C | 1 min | 1x | |
| Hold | 4°C | Hold |
Perform double-sided clean-up as described in the standard 10X Genomics Chromium protocol.
Take 3 µL for QC and store the library at 4 °C for up to 72hr or -20 °C until sequencing.
Use Qubit for quantification and Tapestation D1000 for size estimation.
Sequence to recommended depth based on the number of nuclei estimated from the aliquot cell count in Step 10.