Dec 19, 2021
Version 1
One-step RT-PCR Ins214EPE assay for Omicron (B.1.1.529) variant detection V.1
- Nikita Yolshin1,
- Kirill Varchenko1,
- Kseniia Komissarova1,
- Daria Danilenko1,
- Andrey Komissarov1,
- Dmitry Lioznov1
- 1Smorodintsev Research Institute of Influenza
Protocol Citation: Nikita Yolshin, Kirill Varchenko, Kseniia Komissarova, Daria Danilenko, Andrey Komissarov, Dmitry Lioznov 2021. One-step RT-PCR Ins214EPE assay for Omicron (B.1.1.529) variant detection . protocols.io https://dx.doi.org/10.17504/protocols.io.b2trqem6
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it’s working
Created: December 13, 2021
Last Modified: December 19, 2021
Protocol Integer ID: 55889
Keywords: SARS-CoV-2 RT-qPCR, Omicron lineage detection, VOC detection, 215EPEins, Ins214EPE
Abstract
On 26 November 2021 WHO designated a new variant of concern B.1.1.529 named Omicron. This variant has a large number of mutations, some of which are concerning. Preliminary evidence suggests an increased risk of reinfection with this variant and reduced neutralization by convalescent and vaccinated sera, as compared to other VOCs. Implementation of the high-throughput rRT-PCR screening for Omicron is of great importance for monitoring the spread of this VOC in the population, especially in resource-limited countries lacking sufficient sequencing capacity.
Omicron lineage B.1.1.529 (BA.1) has some indels that turned out to be a good target for its detection. In the current protocol, we use ins214EPE for this purpose. Here we describe the 1-step quantitative multiplex RT-qPCR assay consisting of the newly developed Ins214EPE detection set and widely used Hong Kong University N gene assay for SARS-CoV-2 detection (Chu et al., 2020).
Alignment of the ins214EPE primers and probe to the B.1.1.529 (BA.1) lineage sequence
The assay was validated on the Omicron variant RNA kindly provided by the Pathogenic Microorganisms Variability Laboratory (Dr. Vladimir Guschin, Gamaleya Institute, Moscow, Russia) and RNA from the collection of Smorodintsev Research Institute of Influenza.
| Virus name | GISAID Isolate ID | |
| hCoV-19/Russia/MOW-Moscow_PMVL-O11/2021 | EPI_ISL_7263932 | |
| hCoV-19/Russia/MOW-Moscow_PMVL-O16/2021 | EPI_ISL_7263933 | |
| hCoV-19/Russia/SPE-RII-MH44356S/2021 | EPI_ISL_7717296 |
Virus RNA specimens used for rRT-PCR ins214EPE assay validation
Omicron RNA specimens were positive in the assay as expected. Negative controls were found negative. 10-fold serial dilutions of Omicron RNA were used to assess ins214EPE assay amplification efficiency. The amplification efficiency was 98,9% (R2 = 0,99).
Amplification efficiency of ins214EPE assay
ins214EPE assay amplification curves on omicron RNA serial dilutions
The developed rRT-PCR assay demonstrates high specificity. It was tested on 26 clinical samples (RNA extracted from oropharyngeal swabs) with previously characterized viruses belonging to 8 different SARS-CoV-2 lineages (including Delta B.1.617.2+AY.*) Specific signal was detected only in samples with SARS-CoV-2 Omicron lineage RNA (confirmed by whole-genome sequencing). Specificity was additionally tested on clinical samples positive for other respiratory viruses from the collection of Smorodintsev Research Institute of Influenza - influenza, parainfluenza, human seasonal coronaviruses (OC43, NL63, 229E, HKU1), hRSV, rhinoviruses, bocaviruses, metapneumovirus (33 in total) - with no false-positive results.
| PANGO lineage | HKU SARS-CoV-2 N gene assay, Ct value | ins214EPE assay, Ct value | |
| B.1.1.7 | 15,30 | - | |
| B.1.351 | 16,08 | - | |
| P.1 | 16,15 | - | |
| B.1.617.2 | 16,70 | - | |
| B.1 | 17,47 | - | |
| AT.1 | 18,36 | - | |
| B.1.617.2 | 21,87 | - | |
| B.1.1.7 | 22,49 | - | |
| B.1.617.2 | 24,79 | - | |
| B.1.617.2 | 26,16 | - | |
| B.1.1.7 | 26,24 | - | |
| B.1.1.529 | 26,24 | 26,29 | |
| B.1.617.2 | 28,06 | - | |
| B.1.1.7 | 28,54 | - | |
| B.1.1.529 | 28,84 | 28,72 | |
| AT.1 | 29,65 | - | |
| AY.122 | 31,18 | - | |
| AY.122 | 31,67 | - | |
| AY.122 | 33,51 | - | |
| B.1.1.7 | 33,63 | - | |
| AT.1 | 33,80 | - | |
| AT.1 | 34,01 | - | |
| AT.1 | 35,02 | - | |
| B.1.1.7 | 35,60 | - | |
| B.1.351 | 36,33 | - | |
| B.1.617.2 | 37,30 | - |
Analytical specificity of the assay was checked on 26 samples of 8 different SARS-CoV-2 lineages
| clinical samples positive for | RP assay, Ct value | HKU SARS-CoV-2 N gene assay, Ct value | ins214EPE assay, Ct value | |
| hRV | 32,85 | |||
| hRV | 33,76 | |||
| hRV | 27,75 | |||
| hRSV B | 31,49 | |||
| hRSV B | 30,98 | |||
| hRSV B | 32,33 | |||
| hRSV A | 28,76 | |||
| hRSV A | 30,56 | |||
| hRSV A | 27,70 | |||
| hPIV4 | 23,90 | |||
| hPIV3 | 27,01 | |||
| hPIV2 | 24,72 | |||
| hPIV1 | 28,63 | |||
| hCoV OC43 | 30,34 | |||
| hCoV OC43 | 30,69 | |||
| hCoV OC43 | 28,64 | |||
| hCoV NL63 | 32,20 | |||
| hCoV NL63 | 30,42 | |||
| hCoV NL63 | 24,95 | |||
| hMPV | 30,12 | |||
| hCoV HKU1 | 30,06 | |||
| hCoV HKU1 | 28,30 | |||
| hCoV HKU1 | 30,73 | |||
| Human influenza A (H3N2) | 28,16 | 39,06 | ||
| Human influenza A (H3N2) | 29,13 | |||
| Human influenza A (H3N2) | 28,45 | |||
| SARS-CoV-2 B.1.1.529 | 34,15 | 26,61 | 28,44 | |
| hBoV | 32,26 | |||
| hBoV | 30,75 | |||
| hBoV | 27,25 | |||
| hAdV | 29,47 | |||
| hCoV 229E | 29,11 | |||
| hCoV 229E | 32,52 | |||
| hCoV 229E | 29,37 |
Analytical specificity of the assay was checked on 33 clinical samples positive for other respiratory viruses. RP assay (human RNAse P assay) developed by US CDC was used to check the presence of human RNA in clinical samples
Analytical sensitivity determination is underway.
We consider developed assay to be useful in wide populational RT-PCR screening to assess the spread of Omicron variant.
Order oligonucleotides with following sequences 5'->3':
| A | B | |
| Ins214EPE F | ATATTCTAAGCACACGCCTATT | |
| Ins214EPE R | GGCAAATCTACCAATGGTTCTA | |
| Ins214EPE P | ROX-TGCGTGAGCCAGAAGATCTCCCT-BHQ-2 | |
| HKU-NF | TAATCAGACAAGGAACTGATTA | |
| HKU-NR | CGAAGGTGTGACTTCCATG | |
| HKU-NP | FAM-GCAAATTGTGCAATTTGCGG-BHQ |
Ins214EPE oligonucleotide set developed in Smorodintsev Research Institute of Influenza (St.Petersburg, Russia) tfor specific detection of B.1.1.529 (Omicron) lineage
HKU oligolucleotide set was developed by the University of Hong Kong to detect SARS-CoV-2 in human clinical specimens (Chou et al., 2020)
Please, change the dye if you use ROX as passive reference dye
Briefly vortex and centrifuge reagents before use.
Prepare the PCR reaction mixture following the specifications below:
| A | B | |
| 2X RT-qPCR Buffer | 12.5 μl | |
| 25X RT-qPCR Enzyme Mix | 1 μl | |
| Ins214EPE F | 400 nM | |
| Ins214EPE P | 400 nM | |
| Ins214EPE R | 400 nM | |
| HKU-NF | 400 nM | |
| HKU-NR | 400 nM | |
| HKU-NP | 400 nM | |
| RNA template | 5 μl | |
| Nuclease-free water | to 25 μl |
| A | |
Perform the amplification in a qPCR thermocycler with appropriate temperature profile:
Read a plate at the annealing and elongation step in FAM and ROX channels. Developed rRT-PCR assay was validated for Bio-Rad CFX96, but is believed to work well at any device.
How to interpret the results: detection of fluorescence of FAM probe (HKU-NP) means thepresence of SARS-CoV-2 RNA in the sample, detection of fluorescence in ROX channel (Ins214EPE probe) means the presence of B.1.1.529 (BA.1)(omicron) RNA.
Amplification curves (HKU SARS-CoV-2 N-gene assay - blue, ins214EPE assay - orange)