Apr 14, 2025
Omni-ATAC
- 1Duke University
- Gersbach Lab
Protocol Citation: Samuel Reisman, Charles Gersbach 2025. Omni-ATAC. protocols.io https://dx.doi.org/10.17504/protocols.io.x54v97m9mg3e/v1
Manuscript citation:
Corces, M., Trevino, A., Hamilton, E. et al. An improved ATAC-seq protocol reduces background and enables interrogation of frozen tissues. Nat Methods 14, 959–962 (2017). https://doi.org/10.1038/nmeth.4396
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: April 03, 2025
Last Modified: April 14, 2025
Protocol Integer ID: 126122
Funders Acknowledgements:
NIH
Grant ID: HG012053
Disclaimer
This protocol was adapted from Corces et al. Nat Methods, 2017 for use in the Gersbach lab.
Abstract
This protocol describes methods for performing ATACseq.
Materials
DNase (Worthington #LS002007), HBSS, PBS, Ficoll, RSB (10 mM Tris-HCl, pH 7.4, 10 mM NaCl, 3 mM MgCl2), NP40, Tween-20, Digitonin, 2X TD Buffer (20mM Tris-HCl pH7.6, 10mM MgCl2, 20% Dimethyl Formamide), Tn5 Transposase (#200341970), Nuclease Free H2O, Zymo DNA Clean up Kit (#11-303C), Elution Buffer (10mM Tris buffer, pH 8), Customized Nextera PCR Primer 1, Customized Nextera PCR Primer 2, NEBNext High-Fidelity 2x PCR Master Mix (New England Labs Cat #M0541), SYBR Green I (Invitrogen Cat #S-7563), AMPure XP beads, Illumina Adapter Sequences, Nextera DNA indexes.
Before start
Prior to transposition: make sure cells are viable.
For samples with 5-15% dead cells, treat cells in culture with DNase (Worthington #LS002007) at a final concentration of 200 U/mL. Suspend DNase in HBSS. Treat for 30 minutes at 37C. Wash thoroughly with PBS to remove DNase prior to proceeding to ATAC-seq.
For samples with more than 15-20% dead cells, separate viable cells over Ficoll.
Cell Preparation
Cell Preparation
Harvest cells (no fixation), protocol to be defined by the user. Spin down cells at 500 ×g for 5 min, 4°C. Keep cells on ice for all steps. Ideally, do not process more than 6-8 samples at a time. Cells can be viably frozen to be processed later. If using frozen cells, quickly thaw cells at 37°C and suspend with 10mL growth media. Centrifuge 5 min at 1000 rpm. Wash with 1mL cold PBS once, spin down and proceed to step 2.
Aspirate all supernatant, carefully avoiding cell pellet (may not be visible at this stage), using two pipetting steps (aspirate down to 20-30 μL with a p1000 pipette and remove final volume with a p10).
Add 50 μL of cold RSB (10 mM Tris-HCl, pH 7.4, 10 mM NaCl, 3 mM MgCl2) containing 0.1% NP40, 0.1% Tween-20 and 0.01% Digitonin. Using wide bore tips gently pipette 3 times to suspend the cell pellet.
Incubate on ice for 3 minutes.
Wash out lysis with 1mL of cold RSB containing 0.1% Tween-20 and invert tube 3 times to mix.
Spin down at 500 ×g for 10 min, 4°C.
Aspirate all supernatant, carefully avoiding visible cell pellet, using two pipetting steps. Suspend nuclei pellet in 27 μL 2X TD Buffer by pipetting up and down 5 times. Use 2 μL to count nuclei. If nuclei are too concentrated to accurately count, dilute further with 2X TD Buffer. Adjust 50,000 nuclei to 25 μL total using 2X TD Buffer.
Transposition Reaction and Purification
Transposition Reaction and Purification
Make sure the cell pellet is set on ice.
To make the transposition reaction mix, combine the following (prepare a master mix) then add 25 μL to each sample:
2.5 μL Tn5 Transposase (#200341970)
16.5 μL 1X PBS
0.5 μL 10% Tween-20
0.5 μL 1% Digitonin (Invitrogen #BN2006)
5 μL Nuclease Free H2O
50 μl Total reaction volume
Gently pipette 3 times to mix nuclei suspension with the transposition reaction mix.
Incubate the transposition reaction at 37°C for 30 min in a thermomixer with 1000 RPM mixing.
Immediately following transposition, purify using a Zymo DNA Clean up Kit (#11-303C).
Elute transposed DNA in 21 μL Elution Buffer (10mM Tris buffer, pH 8).
Purified DNA can be stored at -20°C.
PCR Amplification
PCR Amplification
To amplify transposed DNA fragments, combine the following in a PCR tube:
20 μL Transposed DNA
2.5 μL 25μM Customized Nextera PCR Primer 1*
2.5 μL 25μM Customized Nextera PCR Primer 2*
25 μL NEBNext High-Fidelity 2x PCR Master Mix (New England Labs Cat #M0541)
50 μL Total
*Complete list of primers available in Section VI of this protocol
Cycle as follows:
(1) 72°C, 5 min
(2) 98°C, 30 sec
(3) 98°C, 10 sec
(4) 63°C, 30 sec
(5) 72°C, 1 min
(6) Repeat steps 3-5, 4x
(7) Hold at 4°C
Remove tubes from thermocycler and store on ice. Proceed to qPCR amplification to determine additional cycles immediately. To run a qPCR side reaction, combine the following:
5 μL 5 cycles PCR amplified DNA
4 μL Nuclease Free H2O
0.5 μL 50μM Customized Nextera PCR Primer 1
0.5 μL 50μM Customized Nextera PCR Primer 2 (Barcode)
0.06 μL 100x SYBR Green I* (Invitrogen Cat #S-7563)
10 μL NEBNext High-Fidelity 2x PCR Master Mix
20 μL Total
*10,000x SYBR Green I is diluted in 10mM Tris buffer, pH 8 to make a 100x working solution
qPCR cycle as follows:
(1) 98°C, 30 sec
(2) 98°C, 10 sec
(3) 63°C, 30 sec
(4) 72°C, 1 min
(5) Repeat steps 2-4, 19x
(6) Hold at 4°C
After qPCR amplification, manually assess the amplification profiles and determine number of additional cycles to amplify. See Buenrostro et al 2015 (PMID: 25559105) for a detailed explanation. Basically, the additional number of cycles needed for the remaining 45 μL PCR reaction is determined as following:
(1) Plot linear Rn vs. Cycle
(2) Calculate the # of cycle that corresponds to 1⁄4 of maximum fluorescent intensity
Using the remaining 45 μL PCR reaction, run the required number of additional cycles. Most libraries will need 4-8 additional cycles. Anything needing more than 15 additional cycles should be considered as failed. Place the pre-amplified tubes back in the thermocycler without addition of any more reagents. Cycle as follows:
(1) 98°C, 30 sec
(2) 98°C, 10 sec
(3) 63°C, 30 sec
(4) 72°C, 1 min
(5) Repeat steps 2-4, x times
(6) Hold at 4°C
Purify amplified library using 1.2X ratio of Ampure XP beads. Elute the purified library in 20 μL Elution Buffer (10mM Tris Buffer, pH 8).
The workflow for the PCR purification process is as follows:
Add 1.2 μL AMPure beads per 1.0 μL of sample (50 μL for a 45 μL PCR reaction).
Transfer to Eppendorf tube and mix 10 times. Incubate 10 min at RT to bind DNA fragments to paramagnetic beads.
Add magnet and wait until solution clears, about 5 min.
Wash beads + DNA fragments twice with fresh 80% Ethanol to remove contaminants. With beads on magnet, add 200 μL EtOH (or enough to cover the beads), leave 30 seconds, remove all EtOH. Repeat once. Air dry beads 2-3 min at RT, no more than 5 min.
Elute purified DNA fragments from beads. Remove magnet and suspend beads with 20 μL of 10mM Tris, pH 8. Mix 10 times. Incubate 5 min then separate with magnet.
Transfer to new tube.
Indexes
Indexes
A full list of Illumina adapters can be found at Illumina Adapter Sequences (1000000002694).
Nextera DNA indexes (page 16-17):
N701: CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGT
N702: CAAGCAGAAGACGGCATACGAGATCTAGTACGGTCTCGTGGGCTCGGAGATGT
N703: CAAGCAGAAGACGGCATACGAGATTTCTGCCTGTCTCGTGGGCTCGGAGATGT
N704: CAAGCAGAAGACGGCATACGAGATGCTCAGGAGTCTCGTGGGCTCGGAGATGT
N705: CAAGCAGAAGACGGCATACGAGATAGGAGTCCGTCTCGTGGGCTCGGAGATGT
N706: CAAGCAGAAGACGGCATACGAGATCATGCCTAGTCTCGTGGGCTCGGAGATGT
N707: CAAGCAGAAGACGGCATACGAGATGTAGAGAGGTCTCGTGGGCTCGGAGATGT
N708: CAAGCAGAAGACGGCATACGAGATCCTCTCTGGTCTCGTGGGCTCGGAGATGT
N501: AATGATACGGCGACCACCGAGATCTACACTAGATCGCTCGTCGGCAGCGTCAGATGTG
N502: AATGATACGGCGACCACCGAGATCTACACCTCTCTATTCGTCGGCAGCGTCAGATGTG
N503: AATGATACGGCGACCACCGAGATCTACACTATCCTCTTCGTCGGCAGCGTCAGATGTG
N504: AATGATACGGCGACCACCGAGATCTACACAGAGTAGATCGTCGGCAGCGTCAGATGTG
N505: AATGATACGGCGACCACCGAGATCTACACGTAAGGAGTCGTCGGCAGCGTCAGATGTG
N506: AATGATACGGCGACCACCGAGATCTACACACTGCATATCGTCGGCAGCGTCAGATGTG
N507: AATGATACGGCGACCACCGAGATCTACACAAGGAGTATCGTCGGCAGCGTCAGATGTG
N508: AATGATACGGCGACCACCGAGATCTACACCTAAGCCTTCGTCGGCAGCGTCAGATGTG
Protocol references
Corces, M., Trevino, A., Hamilton, E. et al. An improved ATAC-seq protocol reduces background and enables interrogation of frozen tissues. Nat Methods 14, 959–962 (2017). https://doi.org/10.1038/nmeth.4396