Dec 30, 2022

Public workspaceMecA detection Protocol

  • Kabir Umar1,
  • Idris Abdullahi Nasir1,
  • Abdurrahman E Ahmad2,
  • Abdullahi Hassan Kawo3,
  • Abduqadir Magaji Magashi3,
  • Abubakar Umar Anka2
  • 1Department of Medical Laboratory Science Ahmadu Bello University Zaria;
  • 2Department of Medical Laboratory science Ahmadu Bello University;
  • 3Department of Microbiology Bayero Univeristy Kano
Icon indicating open access to content
QR code linking to this content
Protocol CitationKabir Umar, Idris Abdullahi Nasir, Abdurrahman E Ahmad, Abdullahi Hassan Kawo, Abduqadir Magaji Magashi, Abubakar Umar Anka 2022. MecA detection Protocol. protocols.io https://dx.doi.org/10.17504/protocols.io.dm6gpjdy1gzp/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: December 29, 2022
Last Modified: December 30, 2022
Protocol Integer ID: 74561
Funders Acknowledgements:
Tetfund
Grant ID: TETF/DR&D/UNI/ZARIA/IBR/2020/VOL.1/4
Abstract
Polymerase chain reaction (PCR) was conducted for the detection of MecA gene from the Staphylococcus aureus Isolated from both healthcare workers and burns and wound patients using the primers listed in table 3.1. A total PCR reaction volume of 25µl containing primers 2 µl, Pre-mix 15 µl, sample 2 µl, and water 6 µl was used, and a cycling condition, with Initial denaturation at 94 ºC for 5 min, and 30 cycles of denaturation at 94 ºC for 30 sec, annealing at 55 ºC for 30 sec and elongation at 72 ºC for 1 min and final extension 72 ºC 10 min was adopted. PCR amplification was conducted in a thermal cycler (MyCycler Thermal Cycler, Bio-Rad, Portugal) after which agarose gel electrophoresis was run to detect the presence (Band size) or absence of MecA gene as described by Poulsen et al., 2003

MecA gene primers
Gene Primers (3’-5’ Amplicon Size (BP)
mecA F: GGGATCATAGCGTCATTATTC R: AACGATTGTGACACGATAGCC 527